Summary: I'm capturing number of days between two dates with the formula =Now()-N9 in cell O9(for this particular cell, the formula repeats from O9 to O58. The...
Summary: I created a database from data I inherited from another person. The data has three tables ' Mother, Child, Follow up Child data. The data on follow up...
Summary: Hi, I'm designin sort of asset manager software and i'm already stuck with some SQL-querys... :) Tables don't have all the fields yet, because it's ju...
Summary: This from the Help file in Act!: 1. If necessary, perform a lookup to find the contacts for whom you want to create mailing labels or envelopes. 2. Fr...
Summary: I need help making tables with either mySQL or winSQL. Create the -Pilot- table with the following fields, PilotID (integer sequence) and Primary Key...
Summary: I have a file which has the following structure: >sequence1 ACGUCGGAUCUGACUGUAUCG >sequence2 ACGGUAUGUCUGUAUCUGUAUUCUG >sequence3 ACGUAUCUAUCGUAUCUGAU...
Summary: Need help with formula: Example: If you have a product that is priced by the hundreds, I would put the letter "M" in cell next to the price and a f...
Summary: This would waste some space. Use a room file with a day field for every day during the period you want to protect. Flag the field for the reserved da...
Summary: I have two very different reports that I have to run to get all the info out of an inventory database. The first one extracts the current inventory, ...
Summary: for excel 2003...... i have a large range of cells that have mostly different dates, some are similiar. What i need is a formula to count th dates tha...
Summary: I'm new to Access & need some help summing fields from different tables. I have 3 tables: Table Fields Products: Prod Name, Opening stock Supplie...
Summary: Hi there- I'm trying to develop a drop down button/radial where a list of vendors will appear (from a separate table?!) After selecting a specific ve...
Summary: Dear Friends I have developed a Software. Now I need to trap the stability of my product. Please furnish the formulae which can help me in the above s...
Summary: Hello all- Thanks for the responses. @jhunt- Your query will give me the difference in dates, but I actually need the difference between the weights t...
Summary: I agree with Jennifer, The query I would use would: 1. request start date for the current week 2. calculate the end date using DateAdd to add 7 days o...
Summary: Am retrieving a list of appointments (diary) and have a start time, duration and location, together with other fields. Where the location is the same ...
Summary: hi there, I am new to access and trying to create a database to keep track of my working hours and wages. I have a table with a field called "reg hour...
Summary: If the goal is to have all the data in one table, and your Customer Name is all one field (not recommended, but okay for now), make that the Primary K...
Summary: I have a table with data that I want to output using the spool command. The output file is required to have an exact amount of whitespaces after the ...
Summary: I have been trying to manipulate data from a fairly complex database. I am creating a report that is counting a specified field once it has gone throu...
Summary: May I ask if any sql statement to compare date with today and give the result on each record? e.g table Date Name 8/1/2008 Tom 27/12/2008 Ann 2...
Summary: I created a workbook which tracks daily and end of month totals for 12 months. Totals for one month are carried over to the next month. I embedded i...
![[higher confidence]](http://static.computing.net/img/AT-red_x.gif)
- higher confidence, ![[lower confidence]](http://static.computing.net/img/AT-black_x.gif)
- lower confidence
