Computer Problems? Computing.Net has over 1,000,000 posts about all things technology related! Over 90% answered within 24 hours! Click here to start participating now! Also, be sure to check out the New User Guide.
help with shell script
Name: Josef Date: February 16, 2009 at 17:29:40 Pacific OS: Macintosh Subcategory: General
Comment:
I have a file which has the following structure: >sequence1 ACGUCGGAUCUGACUGUAUCG >sequence2 ACGGUAUGUCUGUAUCUGUAUUCUG >sequence3 ACGUAUCUAUCGUAUCUGAUC ...
I would like to extract only the first 15 characters of the lines that do NOT start with '>'. Can anyone help me? THANX!
Summary: Can any body provide me the shell script for checking a filesystem size and once it goes above a provided threshold the automatic backup starts... ...
Summary: I need help making tables with either mySQL or winSQL. Create the -Pilot- table with the following fields, PilotID (integer sequence) and Primary Key NameLast (required) NameInit NameFirst Birthday S...